Primer List

Sno Primer Code Forward Sequence (5'-3') Reverse Sequence (5'-3') Product size (bp) SSR Motif Length of Motif (bp)
1 MiCISH SSR1 AAAATCCCCAGCAACAAATTC TCTTTACGGTTCTCCCAGGTT 238 AAT 15
2 MiCISH SSR2 TGACTTCTTCCGAAAACTTGC GGCTGACAAAAGGGGAGATAC 222 AAC 27
3 MiCISH SSR3 CGTCGAGAGCTTCGGTATAAT GACCACTGCCTCTGGTGGT 225 AGAG 16
4 MiCISH SSR4 TTGGATGGGTATTGAGCTTGA TAGTGTTGTGTGGGGAAGGAG 243 TGATTA 18
5 MiCISH SSR5 AGGAATCCCATCAAGGACAAT CAACAAGGTCGAGGTGAAAAA 250 GGA 15
6 MiCISH SSR6 CTGCTTCCTCCTTTTTCACCT CCACTGTCAAGGCTAAGATCG 252 TTC 18
7 MiCISH SSR7 CCATGCAAGTCATCACCCTAA GGGGCTTTCATACCTTCTCAG 256 ATG 15
8 MiCISH SSR8 GAAGGCATTTCACAGGAATCA CATGTTCTCCATGTTCGGTTT 265 CTCT 12
9 MiCISH SSR9 TTGTCTGCAAAACAACTTCCA TTTTTGGTCTTTGGCTGAGAG 208 ATAT 12
10 MiCISH SSR10 AGGAAAGTGAAGAAGCCGGTA AGCGACATGAAGTTCCTATTGA 235 CTTTTT 18
11 MiCISH SSR11 GGTAGTCGGCCTGAAAATGAT ACTCTGTTCTTCGGGAAATGG 244 AGA 30
12 MiCISH SSR12 GGTAGTCGGCCTGAAAATGAT ACTCTGTTCTTCGGGAAATGG 244 GAGA 12
13 MiCISH SSR13 TCCAATGGAGCAGGAAGATTA GGGTGGACACAAGAAAGTTTG 237 GCA 15
14 MiCISH SSR14 TGCAAATCAGGAAGCTTGATA GGTGCAAAAATGCTGGTTTTA 250 TATA 12
15 MiCISH SSR15 TTCTTCTTATGGCAGCCCTTT GAGAACAAGCTCCTGTTGACG 173 CAA 18
16 MiCISH SSR16 CTAAGCGGTGGGTATCTAGGG TCACTCCTGCTCTGCTTTGAT 249 GAT 15
17 MiCISH SSR17 GGGGAATACCCAACACTAACG CCTTTTCACTGATTTCGTTGC 250 TTC 12
18 MiCISH SSR18 GGGGAATACCCAACACTAACG CCTTTTCACTGATTTCGTTGC 250 ATAT 16
19 MiCISH SSR19 ATGACGGTCACAAACTGCTTC TCGAGGGCATTTCTAATTCAC 250 AGCC 16
20 MiCISH SSR20 ATGACGGTCACAAACTGCTTC TCGAGGGCATTTCTAATTCAC 250 CCAA 20
21 MiCISH SSR21 CATTTTATGGTGCAAGCCAGT TCTCCAATAGAAGCTCCGTGA 192 CATGAT 18
22 MiCISH SSR22 TGTGTATGTGGTAAAGAGGCTCA GCACGAATGGTGAGAGAAGAA 239 CAA 18
23 MiCISH SSR23 ACAGAGGGTTGCTCATTCAGA ACGGCTCCAAAACATGTCTAA 254 ATC 24
24 MiCISH SSR24 GGTGAAGCGTATGAGACTCCA ATTACAAGCCACCACCATCAC 256 GTG 15
25 MiCISH SSR25 GCCATCGAACTGTGATTTCTC CGAAAGTCTCTCCACATGGTT 255 ATAT 12
26 MiCISH SSR26 ATTCCGAGTATCCCATCACCT TCGTGCTTTAAGAGGACATGC 257 TGTC 20
27 MiCISH SSR27 TTCTTCTGTTGGGCAGGTTTA TCGTGCTTTAAGAGGAAATGC 246 TGTC 16
28 MiCISH SSR28 CAAGGAAACAAAGGGTGCATA CCTCAAGACGTATTTGCCTGA 254 CTC 15
29 MiCISH SSR29 AAAGGTGCATCAACCAAGAAA TCCGGAGACTTCTTCACTGAC 242 TGA 18
30 MiCISH SSR30 TTCTTGGCAGACTTGGCTTTA CAGGTAGTTCCTTCCCCAATG 244 ATC 15
31 MiCISH SSR31 TGGACTGGGGATACTGGTTTA GGGGAGTTATTCAAGACCATT 264 CTCT 12
32 MiCISH SSR32 TTTCTTCCAACCCACCATGTA CATCGGATTAGAGTGCTGACC 182 AGAG 12
33 MiCISH SSR33 GATCACCTGCAGAGCTTCAAC GAAGCAGAAATAGCAGGCTCA 258 CATCTC 18
34 MiCISH SSR34 CTGCGTTGAGAGCTAGGGTTA CCCTCTCTCTCTCCCTCTCCT 248 AGGAGA 24
35 MiCISH SSR35 CTGCGTTGAGAGCTAGGGTTA CCCTCTCTCTCTCCCTCTCCT 248 GGAGAG 18
36 MiCISH SSR36 TTCTCGATACCACCATTCTCG GGGGGATGAGGAGAGGATTAT 239 ACC 21
37 MiCISH SSR37 AGTTTTTATGCCCCCTCCTCT GTGAGGAGTCCAGTTGTGGTC 217 ACAC 12
38 MiCISH SSR38 ACCAACCACATGGTGTACCTC CCCTTGCTTACTTCCAAAGCA 241 CAT 12
39 MiCISH SSR39 ACCAACCACATGGTGTACCTC CCCTTGCTTACTTCCAAAGCA 241 ATC 18
40 MiCISH SSR40 CTGCCAAATTCATCCATTTTC ATAGTTGAGGAAGCGGGAGAG 206 CCG 15
41 MiCISH SSR41 CAACTTCTTCCTCCGCTTTCT GTAGCGGAGTGCGCAGAG 270 GCT 21
42 MiCISH SSR42 TTATTACTTTTCGGCGACACC GGGGAAAGATTACTGTTGTTGG 260 GCT 21
43 MiCISH SSR43 GCTGCTTACGAGTTCATGGAG CAAAGGTCCACGCAAATAAAA 222 AGAG 12
44 MiCISH SSR44 CTCTCCCTCCCTAAGCTTCCT TATCTTTTTCCCCCTCCAAAA 225 GAGA 16
45 MiCISH SSR45 TCCTTGTACTCGGACTCATCG CTCCTCCTTTCCCTCACAGTT 245 GTC 18
46 MiCISH SSR46 TGGAAACACTGGATTCCAAAC GTGTTTGTTGGATTTGCCCTA 266 CTCATT 18
47 MiCISH SSR47 GAAAGAGGAACGAGTCGGAGT CCACCTTCTCAGCCACAGAT 237 GGTTAG 18
48 MiCISH SSR48 ACAGCTCAAGAAAAGGGCAAT CCTTCCCTCAGCACTGATACA 241 GGAAA 20
49 MiCISH SSR49 AAGGAGGATGGTGGGAGTAAG CCCAGCCTACCTACCTACAGC 273 GGGTTT 18
50 MiCISH SSR50 AAGTAAGGGATACGGGTCGAG TTCTATCTGCACCCACCCTTT 251 GTAG 12
51 MiCISH SSR51 AAGTAAGGGATACGGGTCGAG TTCTATCTGCACCCACCCTTT 251 GGTTTG 18
52 MiCISH SSR52 TTCCCAATTAATTAAGCCAATGA CCATGTTATTTTTCTAGCTGTCC 239 ATAT 16
53 MiCISH SSR53 GTCATCATCACCCTCAGTGCT GAGTTGACATGGGTTTGAGGA 239 TCT 18
54 MiCISH SSR54 TTGCATTTCTGTCGAAACCTT CCCGAGTCCCCTAAACTCTAA 241 TCA 15
55 MiCISH SSR55 AATCTGGAAAGCTGGCCTTAG TGAGAACATATCACGGGGAAG 241 AGA 15
56 MiCISH SSR56 CAAGTGAAGACCGACCTTGAT GCAACAAAACGTACACACAACA 249 AGAA 28
57 MiCISH SSR57 CCAAATTACTCCTGGCACCTT CAAATTGCAGGACGGTACCTA 256 CTCT 28
58 MiCISH SSR58 CCGCCTGCTTTAAGTTTCAGT CAGGAGTGGCAACTACAATGG 255 ATAT 28
59 MiCISH SSR59 CCGCCTGCTTTAAGTTTCAGT CAGGAGTGGCAACTACAATGG 255 CTAA 12
60 MiCISH SSR60 TTGCTACAACGTCCTCTGACC TGACAGCGTTTATGTCCACCT 256 CCA 27
61 MiCISH SSR61 TCCTTCCGATCCTTCTTTAGC CTGGCTTGGACGACTATTCAG 237 GCA 15
62 MiCISH SSR62 TGCCATTAAAGAAGCCTTGAG TGCAATTTTTGATGTAGGACGA 237 TTTC 16
63 MiCISH SSR63 AAAAATTGGGGGAAAAATCTC TTTGAGACATGCTGTTCGTTG 226 AGAG 12
64 MiCISH SSR64 CCACCAGCTCCAAACTCTCTA TCATGTGGCAACCTGAACTTT 251 GTG 15
65 MiCISH SSR65 CAAAGAGCGTTTGTTTGTTGA TGTCCTGAAAGGAAAATGTGG 251 AGAG 32
66 MiCISH SSR66 CAAAGAGCGTTTGTTTGTTGA TGTCCTGAAAGGAAAATGTGG 251 TTCA 12
67 MiCISH SSR67 CCTTTCATCACGGACTCTTGA CACAAAGAAGAGGGCAACAAA 240 TCTC 16
68 MiCISH SSR68 AAGGGTGATACAAATGCTTGC GTTATTGGAATCGGGAAGAGG 249 ACA 15
69 MiCISH SSR69 AATTAACCCCAGCCTGTGACT CTTGTGGATCTATGGGGACAA 217 TTTGCT 18
70 MiCISH SSR70 CCTGCCTTACGTGTTTGGTAA TGCCTCCAAACCCTACAATAA 236 GAGA 12
71 MiCISH SSR71 CCACAAACTATTCAGTCCTCCA TTCGAAAATCTCTTCTCGGTTC 220 TCTC 12
72 MiCISH SSR72 TTCTGAAGCCACTCTTGGAAA GGGCAATGGTGATTGATATGT 254 CTCT 36
73 MiCISH SSR73 TTCTGAAGCCACTCTTGGAAA GGGCAATGGTGATTGATATGT 254 TATA 16
74 MiCISH SSR74 GATCAGAGCCCAACACGATAA TAACATGGACAGGTTCCGTCT 250 GGTGTC 18
75 MiCISH SSR75 CAAGGGATTTGTTGAAGCAAG TTGAGGTGGTGAAAAGAGGAG 246 TCTT 16
76 MiCISH SSR76 TGCTCCCTTACAACCTCTTGA CCGGGATGAACGGAATATAAA 251 AATA 28
77 MiCISH SSR77 AGATCGAGGAGGAGATTGCAG TTTAGGGCAGCTGCTTACTGA 251 TTGC 16
78 MiCISH SSR78 AGATCGAGGAGGAGATTGCAG TTTAGGGCAGCTGCTTACTGA 251 TGTT 12
79 MiCISH SSR79 ATACAGCAGGTGTCCATGGTT TTTCTTCCACTTCCTCCGAAT 243 TGAG 12
80 MiCISH SSR80 ATACAGCAGGTGTCCATGGTT TTTCTTCCACTTCCTCCGAAT 243 GAGA 12
81 MiCISH SSR81 CCCAGGTACTCTTTGACAATCTG AAGGGTTTGGTGAATTTGAGG 246 ATG 18
82 MiCISH SSR82 CACTTAAAACATTGCTCGGAAA CCATAAGAAAAGCAAAATGGAAA 166 ATAT 16
83 MiCISH SSR83 GGTGGCTAGAACACAAGCAGA AATGCTTCATCAGCCATCAAT 246 TGC 15
84 MiCISH SSR84 TAGGACACAAGCAGAGGATGC AATGCTTCATCAGCCATCAGT 240 TGC 12
85 MiCISH SSR85 TAGGACACAAGCAGAGGATGC AATGCTTCATCAGCCATCAGT 240 TGC 15
86 MiCISH SSR86 ACTTTGGGGGAAACAAAAATG AAGCATCAGCTTCAGGAGACA 243 AAG 18
87 MiCISH SSR87 TTTGAATGAATGACCGTAGTGC TTCCACTTGACAATGTTCTAAGG 227 TATA 16
88 MiCISH SSR88 AAACTTCTTCCCCTTTGACCA CAAAAGGCTGCCAAACATTTA 254 ATCTCC 24
89 MiCISH SSR89 GTGGTTCCTTATTCCCTGGAC CCAGAGATCTGCTTCCCTTTT 251 AGA 21
90 MiCISH SSR90 ACAAACACATCCCCACAAAAG TGAGCTTCGAGTACAAAGTGGA 238 TCAAT 20
91 MiCISH SSR91 TTTGTTCATGAGGCAAATTCC AATTTCTCCAAAATCCCCAGA 248 AGA 15
92 MiCISH SSR92 TTGAAGGATCTTGTGGAGCAG TCCCCAAATCGTTCTTCTTCT 250 AAT 21
93 MiCISH SSR93 CCGTTGATGAAGTTGGCAATA TTGGGAGAAATTTTCGAACTG 253 AAG 12
94 MiCISH SSR94 AGCCAACAAAGAAATGCTCCT TGTGTGTGATGTTCGAAGAGG 204 CTCT 12
95 MiCISH SSR95 ACGTGAACCTCTTGACCATTG GAGAAAGGGGAGAGTCAGGAA 245 CTTCAA 18
96 MiCISH SSR96 TTGACACCCCTAATTGCTCAG AGGTTTTTGGACCTGGTTTGT 196 TCTC 12
97 MiCISH SSR97 TTGACACCCCTAATTGCTCAG AGGTTTTTGGACCTGGTTTGT 196 TATA 16
98 MiCISH SSR98 TGCTTCATGAATGATTGTCCA GTGGTGGACATGGTGGTAAAG 250 CACTTC 18
99 MiCISH SSR99 TTAAGCCCCCAATACGATTCT CATTAGCCTTTAGCAGGTCGTT 253 TTC 18
100 MiCISH SSR100 TCATTAGCCACACGGAGAATC TGCGGATGTCCGATTTAGTAG 261 CTC 15
101 MiCISH SSR101 ACCTCTGCAGATTATCCGTGA TAGATCGTCCGTCAACCAGAC 242 AAAAT 20
102 MiCISH SSR102 TATGGAGACGTTTTCGGTGTT GCTGGTCCTTGCTAAAAGGTT 253 GAG 27
103 MiCISH SSR103 TATGGAGACGTTTTCGGTGTT GCTGGTCCTTGCTAAAAGGTT 253 GAA 12
104 MiCISH SSR104 CGGATCCTCTTCTGTGTCGT TCTGTTTGCTTCTGGAATTGG 251 CAA 21
105 MiCISH SSR105 TTTGTGGAGTCTCCTGCTCTG ATCAACAAGACGCCAGGAATA 251 TGC 12
106 MiCISH SSR106 TTTGTGGAGTCTCCTGCTCTG ATCAACAAGACGCCAGGAATA 251 GAT 15
107 MiCISH SSR107 CAAAACCAAACAAAGATCAGCA AATACTTGGGTCGCTTGGAAT 253 CTTT 16
108 MiCISH SSR108 CGTGAAAGTGAAACACAATGC TTTCCCAAAGGGATGAACATT 227 TATA 12
109 MiCISH SSR109 GATTCCACGCTCAAGTGACTC CAGATTTAGGCAGCGATTGAG 249 AGAGCC 18
110 MiCISH SSR110 CTCATCAGCGATCTGCAAAAT TAAGAGCTTGAGAGCCTGTGC 250 GTGATG 18
111 MiCISH SSR111 AGAAATGGCAGCTACAATGGA CTCTGGTAATGTGGCGACTGT 247 CTT 15
112 MiCISH SSR112 TGTGCCAACCATAACCCTAAA CTTGGGTTCTTTCACATGACC 282 CACA 12
113 MiCISH SSR113 TCCCAGACCCAGAAGAAAAAT AAGGGTGTCGGCTCATAGTTT 256 TCTC 20
114 MiCISH SSR114 TCCCAGACCCAGAAGAAAAAT AAGGGTGTCGGCTCATAGTTT 256 TATA 12
115 MiCISH SSR115 TCCCAGACCCAGAAGAAAAAT AAGGGTGTCGGCTCATAGTTT 256 TGTG 12
116 MiCISH SSR116 CCAGTTTCTGCATGAATTGAA ACAGCACAACCCGGAATAAA 247 AGAG 20
117 MiCISH SSR117 ATAGCCACCTTAGCCAGCTTC TAATTCACTCCAGCGCAGAAT 247 TTGCTG 18
118 MiCISH SSR118 GATGGAAGAAGGGAGGAAATG AATTCCCAAAAGGAGGGATG 245 CTT 15
119 MiCISH SSR119 GTAAAATATCCAAAAACCCCTTA CCAAAACTACCCTTTCCCTCA 249 AAAT 16
120 MiCISH SSR120 AAACAAACCCACACTCAGCAC CCAAATCAAAAGCACCACAAT 253 TCT 30
121 MiCISH SSR121 CTTGCTAATGCCATCATCCAT TAGCTCACTAACCACCGCACT 248 TTGT 24
122 MiCISH SSR122 GCTAGCAAAGAGGTGGATGTG TCCTCTGTCACTTCCTTTGGA 227 TGAAGA 18
123 MiCISH SSR123 ATTTGGGCTAGCAAAGAGGTT TCCTCTGACACTTCCTTTGGA 233 TGAAGA 18
124 MiCISH SSR124 TCCAAGCAGATAGTGCTCTCC TTTCTGTTTTGGTGGAACCAT 211 AAAT 16
125 MiCISH SSR125 TGAAGGTTGTGATTGTACCACTG ATTTCAGTGAGCAACCCCTTT 236 GGT 18
126 MiCISH SSR126 ACATGCCTCGACCCTTTTATT AGGGTACAGGAAGCCCAGTTA 235 GTG 21
127 MiCISH SSR127 ACATGCCTCGACCCTTTTATT AGGGTACAGGAAGCCCAGTTA 235 TCA 12
128 MiCISH SSR128 ACATGCCTCGACCCTTTTATT AGGGTACAGGAAGCCCAGTTA 235 TCA 12
129 MiCISH SSR129 AAGGGGCATTGCTAATTAGTTG GCTGAAAATGAAGGTTGGTGA 261 TGTG 12
130 MiCISH SSR130 TGATCTTGATGCTGATGGTGA AACCAGAAACAACCCCAAATC 246 TTC 15
131 MiCISH SSR131 TGATCTTGATGCTGATGGTGA AACCAGAAACAACCCCAAATC 246 TTTGGT 18
132 MiCISH SSR132 AGCTCCTACAACAACGAATGG CCCTCACATCTACCAAAACCA 233 AAG 21
133 MiCISH SSR133 TGTTAAAAGACAAGCGGGAAA AATCATCATCAAAGAAGCACCA 240 TTTC 24
134 MiCISH SSR134 TGTTAAAAGACAAGCGGGAAA AATCATCATCAAAGAAGCACCA 240 TATC 12
135 MiCISH SSR135 TACAACCCTGGCAGTGAAGAG GGGTCAAACAAAGTGACGGTA 253 TTTTCT 24
136 MiCISH SSR136 AACCAAGCAAGTTTCCAACAA GGAAACCCATATGTTGTTTTGTG 218 ATG 15
137 MiCISH SSR137 CTTTGCAGGCCTTCTCTCTCT CAACGCCAAGATTAAGATCCA 248 TTC 18
138 MiCISH SSR138 TTACACCCCCATCAAAACAAA GGGGAAATCAAAACTCATTCG 257 TCTC 12
139 MiCISH SSR139 CATGGGAATCAGGTTTCATTG TGATAAGGCAACTGTGGTTGG 251 CTCT 16
140 MiCISH SSR140 ATGTGCATGATGATTTTGACG GGTTTCTAGCAGGGACGGTAG 265 GAT 12
141 MiCISH SSR141 ATGTGCATGATGATTTTGACG GGTTTCTAGCAGGGACGGTAG 265 GAT 15
142 MiCISH SSR142 ATGTGCATGATGATTTTGACG GGTTTCTAGCAGGGACGGTAG 265 GATGGG 18
143 MiCISH SSR143 CGTTGAAAAACTTTCCCCAGA GTACGCGGAGAAAATTGGTAA 260 AAAAAG 18
144 MiCISH SSR144 GTGCGTTAAGGTACGGTGAAG ATAAGATGATGGGCTCGGACA 216 TGG 15
145 MiCISH SSR145 CTTCGGCTTCTTGGGATTAGT CAGAAATCTATGGGCAAGCAA 246 GTG 18
146 MiCISH SSR146 CTTCGGCTTCTTGGGATTAGT CAGAAATCTATGGGCAAGCAA 246 TGG 12
147 MiCISH SSR147 GCCTCTGAAGAAGTGGTTCCT TTTTCTGTTGGCTCAAAGGTG 223 TGA 15
148 MiCISH SSR148 TGAAGAGAGAGAGCCATTACGG TGCGAAATTATTCATGTGACC 246 ATAT 12
149 MiCISH SSR149 CCATATCCACAAATGGATTGAT CCTTCCAGCTTTAGTCTTTGG 226 TGTG 12
150 MiCISH SSR150 GGGACAGATGAAGGAGCTGAT GGTCACTTAATCCTGCCCATA 247 TTA 15
151 MiCISH SSR151 ACCCAAGCATAAATCATGCAA CGGCAAAGAAGGCTAAAATTG 252 ATA 15
152 MiCISH SSR152 ACCCAAGCATAAATCATGCAA CGGCAAAGAAGGCTAAAATTG 252 ATAA 12
153 MiCISH SSR153 CCACATTGGAACAACAAAACC AGGAGGAGAAGCCAGTTGAAG 252 ATA 21
154 MiCISH SSR154 TTTTCTTCAGCATACCCCTCA GGGCTGAGCAGAACAGATATT 220 TCA 15
155 MiCISH SSR155 AACCGGGAGGAAAAGTCTACA AGCAACCCGAAATCCTATCAT 268 TAA 24
156 MiCISH SSR156 AACCGGGAGGAAAAGTCTACA AGCAACCCGAAATCCTATCAT 268 TAAA 12
157 MiCISH SSR157 AACCGGGAGGAAAAGTCTACA AGCAACCCGAAATCCTATCAT 268 ATAT 24
158 MiCISH SSR158 GGTGCGGGAAGTGCTTATTAT TGGATTTCAACATGTTTTACCG 234 ATTGGT 18
159 MiCISH SSR159 CCTTGGGTTCTGTGTTGCATA GCAGATGGCAACAAACAAAAT 256 AGG 12
160 MiCISH SSR160 CCTTGGGTTCTGTGTTGCATA GCAGATGGCAACAAACAAAAT 256 CTCT 20
161 MiCISH SSR161 CCTTGGGTTCTGTGTTGCATA GCAGATGGCAACAAACAAAAT 256 TATA 12
162 MiCISH SSR162 TCAAGTGTTTTTGGGTTTTGG TCCACATCAAACAAAGTGCAA 261 ACAC 12
163 MiCISH SSR163 CCATCGTGTAATTCGTCTTCAA CCTTTGTTGCTGCCAAGTTTA 269 AGC 15
164 MiCISH SSR164 GGGGAAAGGAGGATTAGCATA GCCACAGCTAGCCTGATTCTA 265 TCTTT 20
165 MiCISH SSR165 AAGCTTCGTTTCACCAAGATG TCCTGGTTTGTGAATTTGAAGA 242 TGTG 16
166 MiCISH SSR166 ACATTTGTCGAAGCCATTTTG GTGTGATAGGCTGGAATGAGC 249 CTT 15
167 MiCISH SSR167 GGACCTCCCTAAATTGCAAGA TTGCTCCTCTTCATCATGCTT 259 AGA 18
168 MiCISH SSR168 GTAATGGGTATGGTGGCTGTG GGGCATGCCTCTTCTTTATTC 200 ATGG 24
169 MiCISH SSR169 GATAAGCCCAGAACCATAGCC TGAATGGTTTAGGGTTGGATG 242 AAT 21
170 MiCISH SSR170 CCCAACTCCTCCAACTCTCC AACATAAACGGCAACAGTTCG 262 CTCT 12
171 MiCISH SSR171 TTGGTCTTGTGGTGAACATTG CTCAGCTTTGGAGTTCTCATCA 215 TCACAG 24
172 MiCISH SSR172 GATTTTACGCTCTTCCGCTTC ACTGCTAAAGCAAAGGCTGCT 239 GGCTTT 18
173 MiCISH SSR173 TTTGTGTCAATGAGGTCACCA ACTGGTGGAACAGAGTTTGCT 250 ATAT 16
174 MiCISH SSR174 GTCACCAAGATTTGAGGTGGA TTCAACACTGATGGTCCCAGT 256 CCCTCC 18
175 MiCISH SSR175 CAGCTCTTACAGCATCCGTTT TGCTGCTGCTTCTTCTTCTTC 249 AAG 15
176 MiCISH SSR176 CAGCATCCGTTTTTACAATCC TTGTCCCCTTTGCTGCTG 256 GAA 12
177 MiCISH SSR177 CTCGGAGTTCCAAGAAGAAGAA TGTCAATTACCCAACTTGTCCA 248 GAA 12
178 MiCISH SSR178 CTCGGAGTTCCAAGAAGAAGAA TGTCAATTACCCAACTTGTCCA 248 AGC 15
179 MiCISH SSR179 GCTTCAAACTTTCGAGCTTCA GAAAGCAATGTGCAATGGAAT 255 AGT 15
180 MiCISH SSR180 AGAAGCCTTCCATTGTTGTGA AGATTCAACTGGCAGTGTGGT 262 ACC 18
181 MiCISH SSR181 AGAAGCCTTCCATTGTTGTGA AGATTCAACTGGCAGTGTGGT 262 CCT 12
182 MiCISH SSR182 GAGCTGGTGAGGATGCACTAC TTCCCTTACAGGAAGCAATGA 246 TCATCT 18
183 MiCISH SSR183 TTTAAGGCCAGGGTTTTGTCT GTAACTTGGCATCGAAATCCA 225 TTC 15
184 MiCISH SSR184 GGCGAAGATGACGAATCTTTT AAGCAAAGCGTGACTGTGTCT 270 CGG 21
185 MiCISH SSR185 TCTCCTGTAACCACAAAAGGGTA TCTTTTGTTTAGGGCTGCAGAT 254 ATAT 12
186 MiCISH SSR186 CCGTCTCCTCGAAACTCAAG GCCAACTCCTACTACCCCAAC 236 GTG 21
187 MiCISH SSR187 AGAGCATGGATGGAACAAATG CAACCTATCTCACCTCATAAGCA 250 CTCT 12
188 MiCISH SSR188 GTGGAAGCTTTAACCGATCCT CTCGGGAGCTACAACAACAAC 255 TGT 15
189 MiCISH SSR189 TGGGCACTATCTCTTCTCTGC GAATGGTGGTCAGTCTTTTGG 251 TGT 15
190 MiCISH SSR190 CTGTTGCACCAGCTGACACTA TGGATTTGGGTTGACAGTAGG 218 GTTGAA 24
191 MiCISH SSR191 GCACGACGAGCAGAGTAAGAA CAAACGGGCAATAACCAGTAA 227 GTG 15
192 MiCISH SSR192 GCACGACGAGCAGAGTAAGAA CAAACGGGCAATAACCAGTAA 227 GCT 12
193 MiCISH SSR193 CAACCCGTCCTGGATTATTCT CATTTCATGAGCAGTCCGAAT 251 TAAAGT 18
194 MiCISH SSR194 TGGGTTTCAGTTGGTTTATGG TGATTGTCCTCACTCGTCTCC 249 AGAG 12
195 MiCISH SSR195 TGATTGCATTGGTCAATGATG AGGCGGAGAAGAAATACCAAA 250 CTT 24
196 MiCISH SSR196 TGATTGCATTGGTCAATGATG AGGCGGAGAAGAAATACCAAA 250 TTA 18
197 MiCISH SSR197 TGATTGCATTGGTCAATGATG AGGCGGAGAAGAAATACCAAA 250 TTG 18
198 MiCISH SSR198 TCCTCTTCTTCAGCTTCATCG GAAGCTTCGTCTTCTCCCTTC 255 AAATTC 18
199 MiCISH SSR199 AAGCAACTGCTCTTTCCACCT AGAGAGCAGAAGCTGGGACAT 251 CATCTT 18
200 MiCISH SSR200 ATGTGAAATGGTGGAACTGGA TCCTGAACTGCCACCTACTGT 264 TCT 15
201 MiCISH SSR201 TGACAGAAAGTGGTCGTTGAA AAGCCAAAAACCACAGCAAC 249 AGA 18
202 MiCISH SSR202 CGACAGAAAGTGGTCACTGAA CCAAAAACCACAGCAACATCT 240 AGA 21
203 MiCISH SSR203 GCTAGCAGTCTCACGATTTGG CAAATGGAGAGGGTTCAACAA 196 ATA 15
204 MiCISH SSR204 TTTGCAGGATAAGCTGAATGG TTGATTGAAGGGCAAAGAATG 239 TCTC 12
205 MiCISH SSR205 CAGCGTGTGATGCAATCTTTA TATAGGCAGCGTTTCCCTCTT 250 CCGGAG 18
206 MiCISH SSR206 AGGAAAAAGGGAATCATTTCG CACCATTTTGGTGCCATATTC 257 GCG 15
207 MiCISH SSR207 GCAAGTATCCAAACCACCAGA GATCAGCTACAGCGTTTGACC 238 ATAT 20
208 MiCISH SSR208 TGAAATTATGGAAGGCAGTGG GCCATCACCTCACTCTCAATC 234 AAG 21
209 MiCISH SSR209 GGCCCCTACCATTCTTTTCTT TGAGGAGAATGGAGAGGATGA 244 TCA 12
210 MiCISH SSR210 GGCCCCTACCATTCTTTTCTT TGAGGAGAATGGAGAGGATGA 244 TCTTCC 18
211 MiCISH SSR211 CAACTGAAGCAAAAAGCGAAA CAAGACCAAACAAAACCGAAA 241 TTA 18
212 MiCISH SSR212 TTCGGGCTCAGTGAAGATAGA ATAGCTGTTGCTGCTGCTGTT 263 GCA 15
213 MiCISH SSR213 TTCGGGCTCAGTGAAGATAGA ATAGCTGTTGCTGCTGCTGTT 263 CAA 12
214 MiCISH SSR214 TTCGGGCTCAGTGAAGATAGA ATAGCTGTTGCTGCTGCTGTT 263 CAA 15
215 MiCISH SSR215 AATGGGGAGAAGGAGAATGAA TACTTTTCCAAACTGCGTCGT 251 AGGGG 20
216 MiCISH SSR216 TGAGTGGCTAGAGGAGAATGG CCTACAGGGAGAGGAGAGTGG 202 ATAT 12
217 MiCISH SSR217 GTTTCTTCTGCGGCTTCTTTT AAAACTTCGGGAATCTCAGGA 221 TAG 15
218 MiCISH SSR218 CGTTTGAAGATAAGGGGAAGC CAGTTACAGTCCCACCACAGC 255 AGTCAG 18
219 MiCISH SSR219 GGAATTTTGGAAATGGACCTC CAGAATCCCATGCACAAAAAC 242 GAAA 16
220 MiCISH SSR220 CTGAAGAGAATCGTGGACAGC CAAACTCCCTTGCTTTGTCAG 240 GAG 15
221 MiCISH SSR221 ACGGTCTCCGTATGCGACT ACGGAACCACCTGATTTTCAT 223 ACGATG 24
222 MiCISH SSR222 GCGATGATGATCTTGATGAGG GAAGTCGAACAACCGATTTCA 253 TCC 15
223 MiCISH SSR223 ATGCCTATTCGTGGTCGTCTT GCCCTAATCACACCACTTCCT 247 TGG 18
224 MiCISH SSR224 CTTTGATACCTGGCTCACGAA AAGCTTGTTTGTGGATGATGC 251 TCGTCA 24
225 MiCISH SSR225 TCCTCTGCTCATTAGCTCTGC TGCCAGTTTTTCACAACCTTC 231 CAATTG 18
226 MiCISH SSR226 CAGAAGCAGAATACGGTGACG TCCTCTCCAACTGCAGTAACG 251 ACAGCA 18
227 MiCISH SSR227 GCTTCGAGAAGATGACAGTGG TACTACGGCACTCCCCACTAC 239 TGA 21
228 MiCISH SSR228 GTGGCGTCAGAGAATTGTTGT ATCATCGAATGGGTTGATTGA 245 TCT 15
229 MiCISH SSR229 CACGTGCGAATTTTCATCTCT GTGGCGTCAGAGAATTGTTGT 222 AAG 15
230 MiCISH SSR230 GGAGAAAAACGAAAGGGTTGA TCACTCCATCTTCTTCCATCG 225 TAGGGT 18
231 MiCISH SSR231 TGACCGGGAAGTTTAGAGGTT AACAAAACAGCACTGGGATTG 250 AAT 15
232 MiCISH SSR232 CTCTCGTTTTCTCCACAAACCT CAATCGTCTTCCACTTCAAGC 232 CAACAC 24
233 MiCISH SSR233 TGTTTGATGAACCGCTACAGA ACGGTTCCATAATGACACGAA 256 AGT 15
234 MiCISH SSR234 CCCTTTCTTCTCACCCATTTC TTTTCCATGAACTCGACCATC 234 TCTC 12
235 MiCISH SSR235 TCACGTTTTCACCAAATTGAA AGCTATCCTTAGGCTGCCTTG 231 TCT 15
236 MiCISH SSR236 CCAAAACTCATGATCCTCCAC GGGACGGTTGCTTCTGTTAAT 230 CAA 18
237 MiCISH SSR237 TGACGGATCAGAATTTCAAGG TTCCGCCATTTTCATCTTATG 250 TCG 15
238 MiCISH SSR238 CGCTGAAACAACTCGATGACT GTTGCCGGAAACAACCTTTAC 244 AGAACT 24
239 MiCISH SSR239 CACCTATGATGAAACGGGAGA AGATTTGAGGTGTTGGGCTCT 250 CGC 15
240 MiCISH SSR240 CACCTATGATGAAACGGGAGA AGATTTGAGGTGTTGGGCTCT 250 CCA 12
241 MiCISH SSR241 TCCAGGTTGGTTTCCAAGTAA GCAGAATCAAATGATTGGTCA 253 TGC 12
242 MiCISH SSR242 TCCAAGTAACTGTTGCTGCTG CCAACCTTCAAATGCTTCAAA 268 TGC 15
243 MiCISH SSR243 CACACTGCTGCTGTCACTCAT TCAAGGTTGTGTTGTTGGAGA 250 AAAT 16
244 MiCISH SSR244 GGAATCATCAACAAACGATGC ATTGTCCATGACAGGATCAGG 238 TTC 15
245 MiCISH SSR245 TTTCTGCATCGCAGCTTCTTA AGAAAATGATGGGGAAGCTGT 233 GAGA 12
246 MiCISH SSR246 TACTAAAGCGAGCAAGCCAAA TCTGGCCCTTAAGAAGACCAT 255 TATA 20
247 MiCISH SSR247 CAAGCCAACATGAAAATCCAG TGCAAGAAATCGAATTGCTCTA 251 GAGA 16
248 MiCISH SSR248 CCTCGCTTGTTGCGTAGAC TAGGGACGGATGGTCATGTTA 243 CACCCC 18
249 MiCISH SSR249 GCTCTCTTTTGAAATTGAGCAAA AAAATTTCTTGAGCCAAATTCC 245 TGT 15
250 MiCISH SSR250 CAGCCAGCCAACTAAAGAAGA TTTAGGTCTCACAGGGCAGAA 242 TTG 15
251 MiCISH SSR251 CAGCCAGCCAACTAAAGAAGA TTTAGGTCTCACAGGGCAGAA 242 TCTT 12
252 MiCISH SSR252 TGGAGGAAGATGATTCTGCTG AGCCCCTCTTACACCCAAGTA 251 TTA 15
253 MiCISH SSR253 GAGACCGGCTTCTTCTTGG AAGAAGCAGAGACTGGTGACG 240 GCC 12
254 MiCISH SSR254 GAGACCGGCTTCTTCTTGG AAGAAGCAGAGACTGGTGACG 240 CTCT 16
255 MiCISH SSR255 GATTTTGGTGCGTTGAAAGAA TGGAAGAGCCCATTGATGTTA 256 GCTACT 18
256 MiCISH SSR256 TATGCGGTGGATGTGTGGTAG GAAACAACAAGACAACAAACAAA 237 TAT 12
257 MiCISH SSR257 TGGATGTGTGGTAGGGCAATA GAAACAACAAGACAACAAACAAA 230 ATT 15
258 MiCISH SSR258 TGGATGTGTGGTAGGGCAATA GAAACAACAAGACAACAAACAAA 230 ATG 12
259 MiCISH SSR259 TCGAAGCTCACTTCTCCTTCA CCAATCCAATCCTCCTAACAA 245 GAT 12
260 MiCISH SSR260 TCGAAGCTCACTTCTCCTTCA CCAATCCAATCCTCCTAACAA 245 GAT 15
261 MiCISH SSR261 TAACCTTGTAATTCGCCACCA GATGTGCAAACCAAATGGAAG 270 TTC 15
262 MiCISH SSR262 ATGGGTTAGGCCTTGTGAACT AATTTGAACAGAGGAGGGTGAA 253 TTC 15
263 MiCISH SSR263 ATGGGTTAGGCCTTGTGAACT AATTTGAACAGAGGAGGGTGAA 253 ATC 12
264 MiCISH SSR264 AGCCCGTTTAAAGATTGGAGA GGTGTTGGTGTTGTTCTTGGT 259 AGAG 12
265 MiCISH SSR265 CTTCAGGTTTGCGGTGTCATA TTGTTGGCTGCTTTCAGTTTT 228 AAT 18
266 MiCISH SSR266 CGTGCTTACCTTTCTGCAAAT GAGCAAAGATGCAACAAATCC 256 CTT 18
267 MiCISH SSR267 AAAGTTGAGGCATTGCTTTTG CAGTAGGGCTTCGGCTCTTAT 212 CTCT 20
268 MiCISH SSR268 AGTTCTTGACTTGGCCATTGA CATCTCCTGAAGCCTAACCAA 235 TTG 15
269 MiCISH SSR269 GCTTGCTCAAGGAAACAGCTA CGGAACAAAATACAAAAGCACA 251 TATA 16
270 MiCISH SSR270 ACACTTTTCATTCCCATCTGC TTATAACCCAAACACCCAAAAA 241 TATA 12
271 MiCISH SSR271 ACACTTTTCATTCCCATCTGC TTATAACCCAAACACCCAAAAA 241 ATTT 12
272 MiCISH SSR272 GTGATGGTTGATTTGGGTGAC TTGCAGATCCCAATCACTTTC 249 TGG 15
273 MiCISH SSR273 ATATTACCCATTTGGCCCATC GGTTCCCTCAAAATGGTCATAA 259 TCC 15
274 MiCISH SSR274 ATATTACCCATTTGGCCCATC GGTTCCCTCAAAATGGTCATAA 259 ACC 12
275 MiCISH SSR275 TCCATAGGCATCTTCATGTCC CACAAAAGCCAAACAACATCA 247 CCA 15
276 MiCISH SSR276 CCTGAACCTGAGGAGACAGAA AATTAGAGGGCCAGGTTGATG 252 AAAGAA 18
277 MiCISH SSR277 CATCTGGGGAGTTTGTTGAGA AGTCCCAGTCCCAGACTCATT 233 TGCGGC 18
278 MiCISH SSR278 TCCATTCTGATTCTCCCCACT GTTTATTACCGCTCCCCCTTT 251 TCTC 36
279 MiCISH SSR279 CAGAACATCTTCCGGATTCAG TTCCATTCTTCGTCTCCTTTG 245 AGGCA 20
280 MiCISH SSR280 ACGAACAGCCTTTCTCTCTCC GCCAGGTGGAAAACAAAGTAA 225 AAT 24
281 MiCISH SSR281 GCATATGGGTGGTGGAAAATA TAAGTCAATCCATCCGCTCAC 259 AGAAG 20
282 MiCISH SSR282 GTAGCTGGGTCCACGAAAATC CTGGAAACTCCCCAACTTCTC 250 ACC 18
283 MiCISH SSR283 GTACAAGTCTGGCCCACCAC GGCACACATACACACGCTAAA 234 GAGA 12
284 MiCISH SSR284 TCAAGGTTCCATCCTGAGAAG GTGATTCTGGAGGGGCTGTAT 258 AGG 15
285 MiCISH SSR285 TCCTTCAACCCAAAATTTCCT GAACCAACAAATGGCAGCTC 242 TCTC 12
286 MiCISH SSR286 GATGATGGTAACTGGCCAAAA TTGCATCAAGTTTACCGGAAC 258 CCT 15
287 MiCISH SSR287 ATATCACCGCGCCTTTTATTC CATAAATAATGGGGTGGTCAGG 248 TGAGGA 18
288 MiCISH SSR288 ATCAGTAACGACGATCCCACA TCCCCAAAGTTTTCTCTCCTT 246 TCCTCA 18
289 MiCISH SSR289 GAAGGGTTTTGTTCGTCATCA AACAGCCATGAGTTTTTGGTG 253 TCTC 12
290 MiCISH SSR290 CAGCTGCTACCAAGTCTCCTG AGAAGGCATGAACTCTCCACA 266 TCA 15
291 MiCISH SSR291 CAGCTGCTACCAAGTCTCCTG AGAAGGCATGAACTCTCCACA 266 CAC 12
292 MiCISH SSR292 CAGCTGCTACCAAGTCTCCTG AGAAGGCATGAACTCTCCACA 266 CGG 12
293 MiCISH SSR293 CAGCTGCTACCAAGTCTCCTG AGAAGGCATGAACTCTCCACA 266 TCA 21
294 MiCISH SSR294 GAGGCAATCCTGGTGAACATA CTTTATGGACGGCTCCACAT 238 TCC 21
295 MiCISH SSR295 AACATGATAAACGACGGGACA AATGATGGGTCAGGAGGAGAT 249 ATAT 28
296 MiCISH SSR296 AACATGATAAACGACGGGACA AATGATGGGTCAGGAGGAGAT 249 CCACAA 18
297 MiCISH SSR297 CAGCCAGTGAAGCTAACCAAA CCAAAATTTTCCGATGCAAG 255 GAA 15
298 MiCISH SSR298 CAGCAAACACCAACTCGTTCT CCGCTTCAATGGAAGTATTCA 231 GACGGT 24
299 MiCISH SSR299 GATGCTTGCTACTGTCCCTTG CCTCTCCTCATGCTCTGCTTT 254 GAA 21
300 MiCISH SSR300 TCATTTCTACCAACGGACACC CAATCGACTTTCCCCTCAAGT 252 CTT 12
301 MiCISH SSR301 TCATTTCTACCAACGGACACC CAATCGACTTTCCCCTCAAGT 252 TTCT 12
302 MiCISH SSR302 TCATTTCTACCAACGGACACC CAATCGACTTTCCCCTCAAGT 252 TCTCTT 18
303 MiCISH SSR303 TGTTTAGGAGATTGATTGGGTTT GATACGAAATTGTTGGCCTTG 188 CAAGC 20
304 MiCISH SSR304 TGGGAAGTGAAAAGAGTGAGC AATGGTGCAGCATAGCAGATT 230 TCTC 12
305 MiCISH SSR305 TACTGCTGCCAATCTGCTATG GTCACCGGAAACTTCACC 254 TGG 12
306 MiCISH SSR306 TTCTCTCTTGTGCACGTTTCA CGGTTCTTGCATTTGTTCAC 257 TGTGGT 18
307 MiCISH SSR307 GTTGGGAACCACATCCAGTC AGCGGTGGAGAGAGAAGAAAG 251 CTTCT 20
308 MiCISH SSR308 TGATCCCCAAAAGAAGAAAAA AGCTGCCATCACCTCCATAAT 255 TTG 27
309 MiCISH SSR309 CATCTCCATGTACCTCTGTCCA ATGTCTGGTTCAGCATCATCG 249 TCCTCT 18
310 MiCISH SSR310 ATACCTCTGTCCGCTGACCTC ATGTCTGGATCAGCATCATCG 240 TCCTCT 18
311 MiCISH SSR311 GCCATTACTGGCAAATCACTT CCTTCGCAAAGATTGATTGAA 285 GAAT 16
312 MiCISH SSR312 TTTCCACTTCCTGAGACCAGA AGTGGGAGTGGAAGGAGTCAT 247 TTG 21
313 MiCISH SSR313 CAACAAACATTTTGCAAGGAA GGCTTCCTCCTCTTTGTCTTG 257 AAAG 12
314 MiCISH SSR314 AAACACTTTGGAGGCTTTGGT CTCACAGCTACCTCGATCACC 238 TATA 40
315 MiCISH SSR315 TTTCCTCTGGTCCTGAATCCT ACTCGTGCCCCAAGTCTAAAT 256 GAGA 12
316 MiCISH SSR316 CCATTCGGTTGCATCTTATTC CATCGGCTCTAACTTCAATCG 262 AAT 12
317 MiCISH SSR317 CCATTCGGTTGCATCTTATTC CATCGGCTCTAACTTCAATCG 262 GAGA 24
318 MiCISH SSR318 CGTTGATTCTGCTGTTGCTCT ACCTCCCTGCTCTCTCTCTTG 228 AATATA 18
319 MiCISH SSR319 GTGGTTTTATTTGGGACGTGA CTCCAAAATTCATTTGGCTTG 252 TGTG 12
320 MiCISH SSR320 TCTTGTTTGAGCCACTGACCT TGCAGTTGTTGTTGTTGAAGC 234 AAT 15
321 MiCISH SSR321 GGATAAGGCGGTAAAGTTGGA TCTTTGCCCTTTCTTCTCACA 236 CAA 12
322 MiCISH SSR322 CCTCTTCGACTTCCCTCACTT ACCTCAAGGGCCTAACTCAAA 258 GAAGA 20
323 MiCISH SSR323 TTGCAGAGGAGTCTGTCCACT TTGGCAAAAATAACCCAGTAAAA 260 AGAG 16
324 MiCISH SSR324 CTTCAGAGCCGCAGTTACAAG CAGAAGCCACATGCAGACAC 253 ATA 21
325 MiCISH SSR325 ACACACAGTTCCCATGTGCTT AAAGATTTCTTGCTGCAATACCA 246 GAT 24
326 MiCISH SSR326 CCTTGCCTTGAGGTGTAAAAA GAAGAGAAAGGAGGGTCATCG 249 CAC 18
327 MiCISH SSR327 CCTTGCCTTGAGGTGTAAAAA GAAGAGAAAGGAGGGTCATCG 249 CAT 18
328 MiCISH SSR328 ATATTCAACCTCCCGGTTACG AACTACCGCCTTGCGATACTC 243 ATC 15
329 MiCISH SSR329 GCTCTAAGCTTGGCTTCCACT CCCAGATCTTCTCTCGTTTTG 259 TCT 15
330 MiCISH SSR330 CTTGATTTCCCCACTCTCCTC ATCGTCATTGCTCGACGTTAC 217 CTCT 12
331 MiCISH SSR331 TGGAAGAATTATGCGGAATCA GGAGGATGATGGAAGTTGGTT 248 GATGAG 18
332 MiCISH SSR332 CATTGGTCGTTCAAATATCCA TGGTGTGATTTCATTGGACTG 246 GAGGAT 24
333 MiCISH SSR333 GTTTGTCCCGGATACAATCG CGATATCCCTACACCCTTTCC 249 GATATG 18
334 MiCISH SSR334 AGGGCCTTGACATAGACACAA ACCTCAAGAGCTTGGGAATCT 273 ATAT 16
335 MiCISH SSR335 GTATGTAGCCTTTGGCCCACT TTCTCTTCAACCTTGCTGACC 225 ACAC 20
336 MiCISH SSR336 TCTTTGGGGGTACTGAGCTTT AACAAGTGAGAACGCAAGGAA 269 TCTC 12
337 MiCISH SSR337 AGGCAGCACTTCGTGAAATTA CCATACATGAAATTCGGCAAC 241 TGG 15
338 MiCISH SSR338 CTTCTATTCCCATCTGGCTCA GAGTTGATGCTGCGGAATTAG 247 TCT 15
339 MiCISH SSR339 AACTTTGGCCTTATCCTTTGC CAAATCCAGCCTCTTCCTTCT 248 TTG 15
340 MiCISH SSR340 AACTTTGGCCTTATCCTTTGC CAAATCCAGCCTCTTCCTTCT 248 TTG 12
341 MiCISH SSR341 AACTTTGGCCTTATCCTTTGC CAAATCCAGCCTCTTCCTTCT 248 TCT 12
342 MiCISH SSR342 TTATGCTTCCCAAAAGGCTTC TATAACCCAATTGCTGCCCTA 234 TCTC 12
343 MiCISH SSR343 TTATGCTTCCCAAAAGGCTTC TATAACCCAATTGCTGCCCTA 234 TATA 12
344 MiCISH SSR344 ATCCGATCAAAGATGCACAAG GCAGCAAGCGTGTAGAAGGTA 210 AGGG 16
345 MiCISH SSR345 TAGCATCATTGGCAAGGTGAG TGGCATAACAACATTTCAATCA 242 ATAT 32
346 MiCISH SSR346 TGTTAGCATCATTGGCAAGGT AACCATCTATGGCATAACAACA 254 AAAT 12
347 MiCISH SSR347 TTGTTGACCCCAAGTAACCAA GAGAAACCGAGATGAGAAGCA 250 TTA 18
348 MiCISH SSR348 GGATGTGGTCATCTTCCACAC GGCTCCGAACTACACATCAAA 256 TTC 15
349 MiCISH SSR349 CAAAGTTTGAAACCAGAAATGG CCAACTGCAAAATAGCTTTCG 229 AGAG 16
350 MiCISH SSR350 AACCAAGGGTCGAACATTAGAA TCCAAGAATAATCCAACTCTCC 270 AGAG 12
351 MiCISH SSR351 TTCCTCACCCGAAGTAGGATT TGTCGACTGCAGCTTCACTAA 254 AGA 24
352 MiCISH SSR352 AGGCTTTCGCTGTTGTAGTCA ATGGCAGGAGTTGAATGTTTG 249 ATAT 12
353 MiCISH SSR353 CTTCCTTCAACCACACTTCCA CTCATGTGTTTGGCTGCCTAT 279 TCTC 12
354 MiCISH SSR354 AGGCGCAGAGCTAATGAGATT AAACCCTTAGGAGGAGCTGTG 254 GTG 18
355 MiCISH SSR355 ATCTGTCCCAACCCAGAGAAC ATATCTTCGTCCCCAAAGCAT 253 TGT 18
356 MiCISH SSR356 CCACCCACCTCAACTTCAAT ATGGTTCACTAGGCCCAGATT 251 CTC 24
357 MiCISH SSR357 AAGAGGTTGAAGGATCGGATG CCATGCTATTCCACCTCTGAA 236 GAA 18
358 MiCISH SSR358 CTGCAACTGGGGCTGTATTAG AGAAGGTCGAAGAAGGGGAAT 231 TCT 18
359 MiCISH SSR359 GGAAGGAAGCGAATCCAATTA TTTGTTGGTGGGTTTTTCAAC 262 GAA 12
360 MiCISH SSR360 GGAAGGAAGCGAATCCAATTA TTTGTTGGTGGGTTTTTCAAC 262 ATC 15
361 MiCISH SSR361 CCTCATCCTCATCAGCTTCAA TGTGGCCATATTTCAAATCCT 254 GAA 18
362 MiCISH SSR362 CCTCATCCTCATCAGCTTCAA TGTGGCCATATTTCAAATCCT 254 AAG 15
363 MiCISH SSR363 TCTTTTGGTGTTTTGGGTTCA CACAGGAAATCCATCACCAAC 245 CTCT 16
364 MiCISH SSR364 ACTGCCATGGATGTGGTGTAT CATTGATTCATGATTGCCACA 242 TTAGGG 18
365 MiCISH SSR365 AAGGTAAGGGAAATTGAAACCTT TAGCTACCACAACTGCGACAA 200 CTTTG 20
366 MiCISH SSR366 TTCTTCCATTGATGAGGGTAGAT TCTGAAGCTCCATTTCCACTG 200 TTA 15
367 MiCISH SSR367 GCCGTTTTGGTCATGTTACTT CTTCACTACAAGCCGTTCGAG 209 AGAG 24
368 MiCISH SSR368 TTGGTGCGAAAATGAAGAAAG CAAAACAAACAAGGGTTGAGC 195 TGT 15
369 MiCISH SSR369 GGAATTTCTAATCGCCACCTC GACGCATGTCATTCAACCATT 198 TTAA 16
370 MiCISH SSR370 TTCTTTCTCCTCACCCTCACC GGAGAAGAAGCACAACAATGAA 184 CTT 18
371 MiCISH SSR371 CACCTGACAGTATTTGTTGACGA ACAGCATCACTTACCGCAATC 179 GAT 12
372 MiCISH SSR372 TGACGAAGATGATGATGATGAA CGAATCTTCTCCTTCCCACAT 207 AGA 12
373 MiCISH SSR373 ACAATCTTGAGGTTGCCATTG AAAATGTGACCAACCTCTCCA 194 TTTA 16
374 MiCISH SSR374 TAAGGCTGCTAGGGAAAGGAG TTGGCTTCGTCTGAAAGGTTA 214 TGG 18
375 MiCISH SSR375 TAAGGCTGCTAGGGAAAGGAG TTGGCTTCGTCTGAAAGGTTA 214 TGA 21
376 MiCISH SSR376 TTTCATATGCCGATGCAGAAT TCAACCTCTTGATTCTCCTCCT 206 TCA 18
377 MiCISH SSR377 TTTCATATGCCGATGCAGAAT TCAACCTCTTGATTCTCCTCCT 206 CAT 12
378 MiCISH SSR378 ATCCGAACTCGAACTCAGCTT GTAACGTCAACGAGGAGCTGT 192 CTC 18
379 MiCISH SSR379 GAACCCTCCCTTACCTTTTCC CCACTAGAGAGCTTGGTGACG 201 ATAA 24
380 MiCISH SSR380 ACCAGGTGTGCAATCTGAAAG GCTCTGTGAATGGTCCACTGT 196 TCC 15
381 MiCISH SSR381 CAAGCTACACTGGGACTCCTG AAGTCACAGTCTGCGATGGAG 198 CTC 21
382 MiCISH SSR382 AAGTTGATCAGGCACCAAGAA TGAGTCACTCGGAACGATACC 204 ATTA 16
383 MiCISH SSR383 AGGAAAGACGAATCGTTGGTT ATCGTCGTCATCCTCATCATC 210 GAA 15
384 MiCISH SSR384 CCCCAGAAGGAGTTACAGGAG TTTGAAAGTTGCCTTTCTGGA 197 GAAAGT 18
385 MiCISH SSR385 AGATGGATCTCATGGTGTTGC GTCCCAGCAGTTTCATCTGTC 201 AAG 15
386 MiCISH SSR386 GGGTTGCAGTCTTGGTAATCC TGGAGCTCTCATAGAGCCAAG 219 AGC 15
387 MiCISH SSR387 GTATTCATCTCCTTGGCCTGA TGAAAATTGGAGTTGGTCTGG 198 CCTAAC 18
388 MiCISH SSR388 ACTTTCTTCAGCCGCTCTTTC TGTTGAAAAGAAGGAGGATGG 201 CTT 15
389 MiCISH SSR389 AGGTTCCCTCCTAACTTCGTG ATCTCATCGCCAGTTGTCATC 215 CGG 18
390 MiCISH SSR390 AGCCAGTAATAGGGGATCCAA GAGGGAGCCTCCTACAGTGTT 181 GCA 15
391 MiCISH SSR391 GAGGATGGAGTGCTCACTGTC TTGCTTTTAAGCTTCTTGCAATC 206 TTGT 20
392 MiCISH SSR392 TTTGCCATTTTCACCATCTTC CAAGAGTTGGCTGAAGAAAAAGA 207 AAC 21
393 MiCISH SSR393 TTTACCATTGCTGAAAGGAAGA CCAAAATCCTCTGCAAAAATG 201 TTC 15
394 MiCISH SSR394 TTTGCCATTTTCACCATCTTC CAAGAGTTGGCTGAAGAAAAAGA 207 TCTT 12
395 MiCISH SSR395 TAAAACAAGGGCAGCAACAAC TGATCCTGAGTTCCTTTGCAG 203 GTG 18
396 MiCISH SSR396 AGGTTAATCAAAGGTCGCATC AGGAGGAGGAGATGACGTTTC 194 AAT 18
397 MiCISH SSR397 AGGTTAATCAAAGGTCGCATC AGGAGGAGGAGATGACGTTTC 194 ATT 18
398 MiCISH SSR398 TGGGTGAAGGAAAAGAAAACA GTGGGCAGAACCAAATTCTCT 206 TGA 15
399 MiCISH SSR399 TGGGTGAAGGAAAAGAAAACA GTGGGCAGAACCAAATTCTCT 206 GAG 12
400 MiCISH SSR400 TGGGTGAAGGAAAAGAAAACA GTGGGCAGAACCAAATTCTCT 206 GAA 21
401 MiCISH SSR401 TGTGGTCCATTTGTTATGTGC AGCAGGCAATTTGTCAAAGAA 205 TGTTT 20
402 MiCISH SSR402 GCAAATTGGGGATTAGAGGAC CTCATTTTGTCCATGGCTTGT 193 CTCT 16
403 MiCISH SSR403 CAGCATCTATGCCCATGTCTT TTCCTGCAGACCAATTACCAG 201 ATC 15
404 MiCISH SSR404 TTAACCTGGCCATAAGGGAAC CCATGTTGTCAAGGCATAGGT 200 ATT 15
405 MiCISH SSR405 CTCCACCAGGACAGTCTAAGC TTTCATCTGGATCCCACATTC 181 TATTTT 18
406 MiCISH SSR406 ACCTCCATTCACCTCCAACTC GAGAGCATTCCGCTTTGTCTA 176 TCTC 12
407 MiCISH SSR407 CCACACACCGGTAGATCAAAA AATCTGAGGAGAGGAGCCATT 147 CTCT 20
408 MiCISH SSR408 CAATGGCTCCTCTCCTCAGAT TTTTTGCGAAAGGGTCTTTTT 191 TAAT 20
409 MiCISH SSR409 TGATCAAATATCGGAAACATCG TCGCCGAAAAGTTAAAAATGA 187 TCTTCA 24
410 MiCISH SSR410 TTGGATGTGAATGGAAATGCT ATCATAAATGCCAAACCCACA 200 CTT 18
411 MiCISH SSR411 TCATCAACGCAAATAATGCAA GCCATAATTTGCCCCAATATC 198 ATC 27
412 MiCISH SSR412 AGTTCGTTGATCGATTGGTTG TCCATCGCGTCAAAGACTATC 215 GAGA 16
413 MiCISH SSR413 CGGAGCCAGATTCTGTAGAGTT TTTGACTGCATGGAAAAGTCA 209 TCG 15
414 MiCISH SSR414 AAACAGAGGCAGCACTTGAAA TCATCCTCAGCAGGCATTTAT 200 GCT 15
415 MiCISH SSR415R GATCTTACCAAACCCCAACAAA TGCTAAAGCTGAAACCACTGC 195 GAA 15
416 MiCISH SSR416 TGCTGCACCACATTACAACTC TCCACACACACACACACACAC 197 AGAG 32
417 MiCISH SSR417 GATCTTACCAAACCCCAACAAA TGCTAAAGCTGAAACCACTGC 195 GTGT 20
418 MiCISH SSR418 GCGTGTGCTGGGATATCTTAC AAAACCAGATGGTTCCTGGAT 214 TATA 16
419 MiCISH SSR419 GCGTGTGCTGGGATATCTTAC AAAACCAGATGGTTCCTGGAT 214 TATA 12
420 MiCISH SSR420 GTGGTTGAGGATGGTGTTGAT CCTGCTGCCTTGTAGGTGAAT 184 AGA 15
421 MiCISH SSR421 GCTGGAATGAGAAGCCAACTA TGGATTCATCAAATGTGGTTC 194 TCTC 16
422 MiCISH SSR422 AAAGGGAAACTTAACCCTAGCC GCCCTACTTTCACTTCCTCCT 198 GGCT 16
423 MiCISH SSR423 ATTCTTCTCCGGACGTAAAGC CTTCCATCATTTGCTTTTGGA 180 TTC 15
424 MiCISH SSR424 CACACAAAGAAGACGACGATG TACTGCAATCGTATGCTGCAA 188 AAG 15
425 MiCISH SSR425 CGATTGATCAACCTCTTCGAC TCTTCATCCTTCTTTCATTCACA 203 GAAAC 20
426 MiCISH SSR426 GCTTGAAAAGCCAACAAACTG GCCTGTTGCACAATCTTCATT 195 CTTTCT 18
427 MiCISH SSR427 TCGATTTGGGATTTCTGATGA TGCCATTTCATCTTCTTCACC 184 AGA 15
428 MiCISH SSR428 GATGCGTAAGAGGTTGGATGA CGTCCTCCAACAGAAGACAAG 194 GGATTG 18
429 MiCISH SSR429 TAACTCACTCAGCCCAAAGCA TTTGCAACCTCAAAGAAGAGC 166 AAAT 12
430 MiCISH SSR430 TAACTCACTCAGCCCAAAGCA TTTGCAACCTCAAAGAAGAGC 166 AGAG 12
431 MiCISH SSR431 AAACCGTTTTAGCCGACAAAT CCGGAGCTACGAGATGATTTT 205 TCT 12
432 MiCISH SSR432 AAACCGTTTTAGCCGACAAAT CCGGAGCTACGAGATGATTTT 205 CCTCTT 18
433 MiCISH SSR433 ATTTGGATGAGCAGAAACGTG GGATGCGAGATGTGTACTTCC 196 CAATGC 18
434 MiCISH SSR434 TCACCACTACCATCACCACTG CTCTTTCCACAACACCAGAGC 196 CAT 15
435 MiCISH SSR435 GAAGATCTTGGGACCCATTGT ACCTTAGCTCAAGCTCCTCCA 200 ATG 21
436 MiCISH SSR436 AATTAGTGAAGGCAGTCTCCTG CCTCAACTTTTTAAGCACACCA 166 ATT 18
437 MiCISH SSR437 TGGTGTGCTTAAAAAGTTGAGG GAACCCGTCGTTCTTTCTTTC 222 ATAT 16
438 MiCISH SSR438 TGGGTGGAATTAAAGTCGAAA CTGGTTTCCTGAGCATGTGTT 197 AGAG 40
439 MiCISH SSR439 CACCTATTCAAGGTGCCAGAA CCTCGTTGAGACCAGTACAGC 199 AGC 15
440 MiCISH SSR440 GCCTCCCAATCGATAAAATTC GGAGGATGAAGAGGAGGAAGA 201 CCG 21
441 MiCISH SSR441 ATGATCTGGCAGGTGATTACG CCATATCCCCCTCTACTTCCA 193 TGG 21
442 MiCISH SSR442 TCCTCTCATCTTTGCTGCTGT CGAAACCAGATCCACTTCAAA 214 GAGA 24
443 MiCISH SSR443 CTTCCGCCCTCTCTTTCTCTA AAACAAGTTTTGGGGTTGAGC 197 TCT 15
444 MiCISH SSR444 CTTCCGCCCTCTCTTTCTCTA AAACAAGTTTTGGGGTTGAGC 197 TCTTCG 18
445 MiCISH SSR445 CTGTGTACGAGCTCTGCCTCT GCACCCAGGGACCTATAAAAG 187 GAGA 16
446 MiCISH SSR446 TCATGCTACAGGATCACAGCA TGGTTGGACCTGGGAATTACT 199 GCA 12
447 MiCISH SSR447 TCATGCTACAGGATCACAGCA TGGTTGGACCTGGGAATTACT 199 CAGCAA 24
448 MiCISH SSR448 GCAATCCAGCTTGCTAAAGAA TTACAGGCTGCGATGAGTTTT 190 CAACAG 18
449 MiCISH SSR449 AGTAGGGGTTCCAATTTTCCA CTACGTGGGTCCAAAACAGTC 198 AGGCTC 18
450 MiCISH SSR450 AGCGATGGACCGTTCAATTAT CTTTCTTGCTGTAACCGCATT 199 ATTT 16
451 MiCISH SSR451 CATCAGAAGCTGGGTTATGGA CTGGCAGTTAAGACCTTCAGC 196 TGTG 12
452 MiCISH SSR452 TTAGACCCGTCCCAAACTCTT GGAATCCTCCAACACCAAACT 206 CAC 21
453 MiCISH SSR453 TGGAAGCAGTCAAGTGCTCTAT AAAACTCGGATTTTCCCTCAG 205 ATAT 12
454 MiCISH SSR454 ATCTCTTGTCTAGCCCCTGGA GGTTAGGAAGCTCGGATTCTG 199 ATAT 16
455 MiCISH SSR455 TTTCTGGGGATCGTAACAGAA AATGAACCACGAAGACAATCG 207 TTTG 12
456 MiCISH SSR456 TTTCTGGGGATCGTAACAGAA AATGAACCACGAAGACAATCG 207 ATAT 12
457 MiCISH SSR457 TTGTTTGGGTAGAGTGTTCAGC GAAAACCAATATCAAACGAAACG 197 TTTGT 15
458 MiCISH SSR458 TTGGGGGAGAGTAGTTTACGG CACTCTCCAAAGCTGGCATAC 199 GAGACA 24
459 MiCISH SSR459 TCGACGACACCAGTAATAGGG ACTGGTCGGATGACATTTGAA 195 TCTC 12
460 MiCISH SSR460 TGCATGCACAATCAAACTTTC CAACCTTAAAACTCCCCCTTTC 203 ATAG 16
461 MiCISH SSR461 GCCAGTGATGGTTATGGAATG CTTCCCTTTTGAAGAGCAAGC 199 TGATCC 18
462 MiCISH SSR462 GGGTTCTGATCTCCCATTGTT GCGGCATAACTCAACATCACT 210 CGTG 16
463 MiCISH SSR463 TCCAGATGCTGGGTTAGTCTG TGATGAAGCATTGGTGATTGA 196 TCA 18
464 MiCISH SSR464 TCAGCAATTGTCTCCTGGTTC TCAAGGCTGATTCTGATGGTT 199 TTTC 16
465 MiCISH SSR465 GGAAAAACCCATCTGGTGAAT GTTTCCATCCTCCCAATGTTT 191 AAAG 16
466 MiCISH SSR466 GAACTTGGTCCGGATGGTACT ACGATCTTGCCCTACAACAAA 195 GAAGAC 18
467 MiCISH SSR467 AAGTGAGAGTGGGGTGAAGGT CCAACCACCCACAACCTAAAT 199 GTGA 16
468 MiCISH SSR468 CAATGCATCAGCTCTCCAAAT CCCTTCTTGCTCACTCTCTCA 200 GTA 15
469 MiCISH SSR469 GGGAGAAGAAGGAGAACGAGA AGTCAATGGAAAGAGCAACCA 202 GTT 12
470 MiCISH SSR470 GGGAGAAGAAGGAGAACGAGA AGTCAATGGAAAGAGCAACCA 202 GAA 18
471 MiCISH SSR471 GCTCCCTCGACTAAATTCCTG TTGTTGTGAGTGATCGTGAGC 192 GCT 15
472 MiCISH SSR472 CTGTTCCTCCTAATCCCCTTG AGCCTTCAGCTCTCCAACTTC 198 TGTTGC 18
473 MiCISH SSR473 GGTCAGGTCAGCGTAGGTAGA CATCAATTTTGGCTTCTGCAT 196 CAT 15
474 MiCISH SSR474 GCATGCAGACACAACTTATGC ATGGATGCCATGTCAGAAGAC 199 ATAT 16
475 MiCISH SSR475 ACTTTTGGTCTCTTTCGCACA AAGGTCCCACACCCATGTAAT 190 AGAG 12
476 MiCISH SSR476 ACTTTTGGTCTCTTTCGCACA TCTCTATCAAAGGCCCCACAC 199 AGAG 12
477 MiCISH SSR477 TCCAGGTTTCTTCGTACTTCG ATGGTGAGGCCTTATACGATG 204 CTT 15
478 MiCISH SSR478 CGGCACTCTCAAATCTACGTC TTGCAAGTGAGGGAGAGGTAA 202 CTCT 12
479 MiCISH SSR479 CGGCACTCTCAAATCTACGTC TTGCAAGTGAGGGAGAGGTAA 202 TCTC 12
480 MiCISH SSR480 TCTAAACCTTCCCAGCATTTG TTGAAGAAGGGTTTTCGGAGT 198 TATA 20
481 MiCISH SSR481 CCTTTTTGCTCTTCATCAACG ATTTGCCATTTCCACCTCTTC 187 TGTG 16
482 MiCISH SSR482 CAGACAAAATCACACGTTGAAA AAGGTTGGATACGGAGGAATC 179 ATAT 16
483 MiCISH SSR483 CCAGAGGTATGAACAAAGAGGTG TCCCTTTACTGCAGAAACTCAA 200 TGTG 12
484 MiCISH SSR484 GGCTCTGTCTGTCTCTCAGCTT CGTGTTTGGTTTGAGTGAACC 211 CTCT 28
485 MiCISH SSR485 ATGCGTGAGCTTGTTACAGGT CGCTGTGAAATGGTTACTGGT 201 TCT 18
486 MiCISH SSR486 GGTTCTGAGTTTGACCACCAA GGTCCCTCCAAAGTAGGTTGA 188 TCC 18
487 MiCISH SSR487 GGCTCTCTTTACGACCTCCAC TCGACGAGGAATCAGAAGAAA 197 CAC 15
488 MiCISH SSR488 GCGCCAGCTAAGAGTGTTAAG TGGGTATTACATGGACCCACA 183 CGAAGG 18
489 MiCISH SSR489 AATGGAGGATGATGAGATGGA GGTCGGAGAACAGGTCTTCAT 200 AATCTC 18
490 MiCISH SSR490 TTTTCCATCAAGCCAGTCATC ATTGCAGCTGTCGTGAAGAAC 191 TCC 15
491 MiCISH SSR491 ACCTACCGACTAAAATTAGCAA GCTGGAGATCTTGTCGTCATC 202 GAA 27
492 MiCISH SSR492 TATTCTCAACATTGCGGGTCT ATTCCTTCCATTTTGGATGCT 192 TCT 15
493 MiCISH SSR493 GAAGCTCATGGCCTCTCTCTC TTCTATGCCGACAAATGCTCT 202 TCC 15
494 MiCISH SSR494 AATCCTTGCTTGGAACTCTGC GGCTCCTGCAACTTCTTTGTT 202 AAG 15
495 MiCISH SSR495 ATCCCAACAATGACTCCATCA AAATGCCCATCAAAACAAACA 195 TCT 18
496 MiCISH SSR496 TTGTTATCGTCGTCATTGTGG CAGAGCCTACGACGAAGCTG 200 TGT 15
497 MiCISH SSR497 TCTCGTCCTCTCTTCTGTCCA AGCTGGTGAGATGTCTGCAAT 198 GAA 15
498 MiCISH SSR498 TCTCGTCCTCTCTTCTGTCCA AGCTGGTGAGATGTCTGCAAT 198 AAG 15
499 MiCISH SSR499 CAACAGAACACCTCAGCTATGC AGTGATGATTGGCATCTCAGG 198 CTCAA 20
500 MiCISH SSR500 GTAGTCTCCGAACCCACTTCC TGGCAAACTGGAAGAGAAGAG 202 GGT 15
501 MiCISH SSR501 GTAAGTCCTGGTGCTTGGTTG CAAATTTTTCAAAGCAAAGTGG 200 AGC 15
502 MiCISH SSR502 TCTAGCCAATTTGGTGTCAGG AACAACACGCAGTGGAAGTCT 199 ATGC 16
503 MiCISH SSR503 AGGAGTCCCCTTGCAGTAAAG CCTTGATGAACTGCTAAAACCA 163 AGC 18
504 MiCISH SSR504 TTTATCACATGAACATGGCTGAC GAATAGAAGGCAAATACAATGGA 120 TGTG 20
505 MiCISH SSR505 TTTATCACATGAACATGGCTGAC GAATAGAAGGCAAATACAATGGA 120 ATAT 12
506 MiCISH SSR506 AGCATAATCCTCCTGCTCACA TAAGCAGATTCAGCTGGCAGT 183 CTG 15
507 MiCISH SSR507 CTTCCAACACAACAATCAAACA CGGAGACTTCGAAACCTAAGC 192 TCA 24
508 MiCISH SSR508 GCTTGGTTCGAAAGCTGAGTA GAAGCCAGCTAATCCATTTCC 194 AAGAGA 18
509 MiCISH SSR509 GACGACGTGTCGTTTTCACTT AATTGGGAGAACAGGAGCAAG 200 GTT 15
510 MiCISH SSR510 GACGACGTGTCGTTTTCACTT AATTGGGAGAACAGGAGCAAG 200 TGT 12
511 MiCISH SSR511 GGGAGGAGTTATACCGGTCAG TCCTGATCCTTCAACAAAATCT 218 TATG 16
512 MiCISH SSR512 TCGGAAAGGAGTGAAGAGAGG TCCTCCTCCATTTCTCAGTCA 209 GAA 15
513 MiCISH SSR513 TGATAAGGCAGCCATTGAAAC TTTTCCGGTCTGGATATAGCA 162 GGA 15
514 MiCISH SSR514 TCAACATCAAAGAGCACATGG ACGGACAAACAAACTGGATCA 190 CCG 15
515 MiCISH SSR515 AACTTGTCGTCACTCCCCTCT TCTCGGGTGCTCTTGAGATTA 186 CAAA 12
516 MiCISH SSR516 TTACTGCCTCCAACAACAAGC TCAAGTGGGAAATGAGATTGG 196 CAAAAA 18
517 MiCISH SSR517 GCTCTGAAACAAGAGCCCTAAA AAAATGATGAGGCTGAGAGCA 195 ATC 21
518 MiCISH SSR518 CAACTGCAACTTCAAATTTTCG TTCTGAGCCCTCATCTACCAA 194 GAT 15
519 MiCISH SSR519 GATCTTGCTCCTTTTGATCCT ATCCCCACTCTCCTCATTCAA 204 AAG 18
520 MiCISH SSR520 TGCAGATGATTCTGTGGACAA TAGCCCTGTCTCCTTCTTCCT 197 AAG 15
521 MiCISH SSR521 TGAGTCCCAGAAATCATCGTC TTCCAATTGGGAAACAAAACTT 199 ATT 24
522 MiCISH SSR522 CACATCCTGGCCAACTTACTC GCTTGGATGTTGAATGTGTGTT 207 TTC 18
523 MiCISH SSR523 TTGTCAACAAAGAAATGCATCA ATATGCGGTCCTGAGTTGTTG 170 TAA 15
524 MiCISH SSR524 TTCAGACTCCACCGAAATGAC GCTTCTTCGGTAGTGTGGCTA 197 GCA 15
525 MiCISH SSR525 TGATTCCTCATCTGCCTCACT CAGGAATATCGGGACATTGAA 202 CTTCAT 24
526 MiCISH SSR526 AGTGCTTCCCTCTGAATCCTC TAATACAAACCCCGTCGATCA 202 ATT 15
527 MiCISH SSR527 AACCCACATTCAACTTCATGC CATGCGTTGGCTCTCTACTTC 207 AAAAAG 18
528 MiCISH SSR528 TCTGAGTCCGACCCTAGTGAG ATGCTCAACCACACTTTGACC 192 AATCAA 18
529 MiCISH SSR529 TTTTGGGCTTGCATCTATCAG ACCTCCAACTCCGAAAAGAAA 205 CTCT 12
530 MiCISH SSR530 GTATGCCATTGGGAAGGTTTT TTCCAACATCGGAATTCTCTG 202 TGC 21
531 MiCISH SSR531 AGATCGAACCTCGGTGGTTAT CCCATTTGTACTCCCATTTGA 204 AATGGA 18
532 MiCISH SSR532 GCCCAGTTCTTCCTAAACAGC TAGCTGGAAATCGGAAAGGTT 196 GAGA 12
533 MiCISH SSR533 GAACAAAAATGGCAAACCAAA AATACTGCATGGGCTTTCTCA 197 AGAG 12
534 MiCISH SSR534 AGCGAGCTCAACAGATTTGAA GTTAGGTCCTGCATCCTGTGA 186 GTG 15
535 MiCISH SSR535 GAGGCCTGATCCACTTGAAAT CGTTTTGGTGGATCATCAGTT 200 ATC 15
536 MiCISH SSR536 CACCTTCCCCTAACTCACACC GCGAAATGCATCAGAGAGAAA 202 TTC 18
537 MiCISH SSR537 TCGAACGAGGTCTTAACAGGA GAAATGATTTTGCGGGTTGT 194 AGAG 16
538 MiCISH SSR538 GGCAGAGAGAGAAGCATTGTG TGCCCATATCTTCAACCAGTC 206 GGT 21
539 MiCISH SSR539 TTAAATGGGTGGCATGGTTTA CCTTTTCACTGATTTCGTTGC 203 ATAT 16
540 MiCISH SSR540 ACTCACGCGTTTGACATTCTT ACTCTGCAACTCACCCTGAGA 210 CAGCAA 18
plant plant plant plant plant plant plant plant plant
Copyright © 2018 National Mango Database, All rights reserved.